A Skeptic Over Coffee: Young Blood Part Duh

Does this cloudy liquid hold the secret to vitality in your first 100 years and beyond? I can’t say for sure that it doesn’t. What I can say is that I would happily sell it to you for $8,000.

Next time someone tries to charge you a premium to intravenously imbibe someone else’s blood plasma, you have my permission to tell them no thanks. Unless there’s a chance that it is fake, then it might be worth doing.

Californian company Ambrosia LLC has been making the rounds in publications like the New Scientist hype-machine to promote claims that their plasma transfusions show efficacy at treating symptomatic biomarkers of aging. Set up primarily to exploit rich people by exploiting younger, poorer people on the off chance that the Precious Bodily Fluids of the latter will invigorate the former, the small biotech firm performed a tiny study of over-35s receiving blood plasma transfusions from younger people. It’s listed on clinicaltrials.gov and everything.

First of all, to determine the efficacy of a treatment it’s important that both the doctors and the patients are blinded to whether they are administering/being administered the active therapeutic. That goes all the way up the line from the responsible physician to the phlebotomist to the statistician analyzing the data. But to blind patients and researchers the study must include a control group receiving a placebo treatment, which in this case there was not. So it’s got that going for it.

To be fair, this isn’t actually bad science. For that to be true, it would have to be actual science. Not only does a study like this require a control to account for any placebo effect*, but the changes reported for the various biomarkers may be well within common fluctuations.

Finally, remember that if you assess 20 biomarkers with the common confidence cutoff of p=0.05, chances are one of the twenty will show a statistical difference from baseline. That is the definition of a p-value at that level: a 1 in 20 chance of a difference being down to random chance. Quartz reports the Ambrosia study looked at about 100 different biomarkers and mentions positive changes in 3 of them. I don’t know if they performed statistical tests at a cutoff level of 0.05, but if so you should expect on average 5 of 100 biomarkers in a screen to show a statistical difference. This isn’t the first case of questionable statistics selling fountain of youth concepts.

All of this is not to say that the experiments disprove the positive effects of shooting up teenage PBFs. It also generated zero conclusive evidence against the presence of a large population of English teapots in erratic orbits around Saturn.

You could conclude by saying “more scientific investigation is warranted” but that would imply the work so far was science.

* The placebo effect can even apply to as seemingly objective a treatment as surgery. Take this 2013 study that found no statistical difference in the outcomes of patients with knee problems treated with either arthroscopic surgery or a surgeon pretending to perform the surgery.

I

­A Skeptic Over Coffee – Young Blood

dsc_0005

A tragic tale of a star-crossed pair,
science vs. a journalist’s flare

When reporting on scientific topics, particularly when describing individual papers, how important is it for the popular coverage to have anything to do with the source material? Let’s take a look at a recent science paper from Justin Rebo and others in Nature Communications and the accompanying coverage by Claire Maldarelli at Popular Science

Interest in parabiosis has increased recently due to coverage of scientific papers describing promising results in mice and the high-profile of some parabiosis enthusiasts. Parabiosis, from the Latin for “living beside”, typically has involved stitching two mice together. After a few days the fused tissue provides blood exchange through a network of newly formed capillaries.

The most recent investigation into the healing effects of youthful blood exchange from Rebo et al. expands the equipment list used for blood exchange beyond the old technique of duct-taping two animals together surgically joining two animals. Instead of relying on the animals to grow new capillary beds for blood exchange to occur, the authors of the new paper used a small pump to exchange a few drops of blood at a time until both mice had approximately the same proportion of their own blood and that of a donor and vice-versa.

According to the coverage from Popular Science:

While infusing blood from a younger mouse into an older mouse had no effect on the elderly mouse in the latest study, infusing blood from an older mouse into a younger one caused a host of problems in organs and other tissues.

Just a few paragraphs further Maldarelli quotes Conboy (last author on the paper) as saying “‘This study tells us that young blood, by itself, cannot work as medicine’.” In contrast, in the paper the authors state that “Importantly, our work on rodent blood exchange establishes that blood age has virtually immediate effects on regeneration of all three germ layer derivatives.” and later that “. . . extracorporeal blood manipulation provides a modality of rapid translation to human clinical intervention.”[1] There seems to be a bit of disagreement between the version of Conboy on the author list of the scientific article and the version of Conboy quoted in the PopSci coverage of the same article.

We also learned from Maldarelli that the tests reported in the paper were performed a month after completing the blood exchange procedure, but the longest duration from blood exchange to the experiment’s end (sacrifice for post-mortem tissue analysis) was 6 days after blood exchange.

I came across the PopSci coverage when it appeared on a meta-news site that highlights popular web articles, so it’s safe to assume I wasn’t the first to read it. Shouldn’t the coverage of scientific articles reported in the lay press have more in common with the source material than just buzzwords? The science wasn’t strictly cut and dried: not every marker or metric responded in the same way to the old/young blood exchange, and while I agree that we shouldn’t be encouraging anyone to build a blood-exchange rejuvenation pod in their garage, the findings of the article fell a long way from the conclusions reported in the lay-article: that young blood had no effect on the physiology of old mice. This is to say nothing about the quality of the paper itself and the confidence we should assign to the experimental results in the first place: with 12 mice total* and a p-value cutoff of 0.05 (1 out of every 20 experiments will appear significant at random), I’d take the original results with a grain of salt as well.

This is the face of science we show the public, and it’s unreliable. It is no easy task for journalists to accurately report and interpret scientific research. Deadlines are tight, and writers face competition and pressure from cheap amateur blogs and regurgitation feeds. “What can I do to help?” you ask. As a consumer of information you can demand scientific literacy in the science news you consume. Ask for writers to convey confidence and probability in a consisent way that can be understood and compared to other results by non-specialists. As a bare minimum, science and the press that covers it should at least have more in common than the latest brand of esoteric jargon.

If we only pay attention to the most outlandish scientific results, then most scientific results will be outlandish.

*The methods describe a purchase of 6 old and 6 young mice. However, elsewhere in the paper the groups are said to contain 8 mice each. Thus it is not clear how many mice in total were used in these experiments, and how they managed to create 12 blood exchange pairings for both control and experimental groups without re-using the same mice.

[1] Rebo, J. et al. A single heterochronic blood exchange reveals rapid inhibition of multiple tissues by old blood. Nat. Commun. 7, 13363 doi: 10.1038/ncomms13363 (2016).

A skeptic over coffee: sick of lab meetings

rhinovirus

This post brought to you by a dedicated community of human Rhinovirus ( pdb model 1AYM).

Imagine the following dialogue between researchers:

Wayne the Brain: “Third one this week ::Cough:: I am literally sick of lab meetings.”
Wankdorf: “Oh I feel ya. There are way too many lab meetings. It’s a real waste of time, but that’s the cost of pulling from so many different realms of expertise in interdisciplinary projects.”
Wayne the Brain: “No no no, I am literally sick of lab meetings. All the exposure is really taking a toll on my health. ”
Wankdorf: “Why didn’t you say so?! Stay away, you purveyor of vile pestilence! ::cough::”

I hope, dear reader, that you spotted the root cause of their misunderstanding. Wayne (the Brain) was hypothesizing a suspected transmission rate while simultaneously advertising his own condition as definitely infected and possibly contagious. Wankdorf (unsurprisingly) misinterprets the statement by applying a more colloquial definition of the term “literally.” It’s not clear whether infection of the second researcher could have been avoided and the spread of the disease slowed had they practised more effective communication, but that scenario is plausible given what we know.

Of course this is an extreme example, and the consequences may not always be so dire. The most frustrating part of the above exchange and subsequent misunderstanding is that neither participant was strictly wrong in the definition they assumed for “literally.” This word now literally can be used to say “in the truest sense of the words” and the exact opposite, and my brain literally imploded when I learned about the new definition.

If you don’t believe me, check out the definition in both the Cambridge and Merriam-Webster online dictionaries. I’ve screenshotted the definitions to preserve this embarrassment for posterity:

merriamwebsterliterally

cambridgeliterally

Language is dynamic, some (Wankdorf etc.,) would even say that it is dynamical. Hence it doesn’t make you appear smarter to bore your friends by talking about Romans every time they say “decimate.” Language is constantly changing in response to the selective pressures of popular usage, subject to many factors as people and cultures interact.

Similar to many other examples of evolution, humans affect the way a language changes by taking note of and modifying the selective pressures they individually exert. The consequences may be particularly important in science, where English is the common tongue but not in general the first language of most practitioners. I expect that modern English will evolve to encompass multiple forms based on usage. Native speakers sat on the British Isles, laying in North America, and so on will continue to retain and invent complexity and idiosyncrasy, while international English will come to resemble a utilitarian version of Up-Goer Five English, paring off superfluous complexities while retaining the most effective elements to become as simple as possible, but no simpler. It’s possible that international English will even retain sarcasm.

Pop quiz: what’s your favourite English speaker idiosyncrasies used in this article?

Now I get it!

glasgowCyclists

Credit for this gem goes to the Glasgow University press office (http://www.gla.ac.uk/news/headline_388852_en.html), with a nice spin added by the BBC (http://www.bbc.co.uk/news/uk-scotland-glasgow-west-30944584).

From the BBC: “Complicated? Oh yes. Which is why the researchers say it might help to think of a bicycle race.” Don’t worry your pretty little head about these bothersome physics, stick to fun things like sport. But in all fairness, a peloton does tend to slow down when it collides with a Spatial Light Modulator, or any equpiment attached to an optical table for that matter. . .

We mustn’t liken a black hole to a baked good

We also mustn’t use the royal we

A prevalent mindset in science journalism is that in order to make a subject accessible, it first must be dumbed-down. I suggest we all make efforts to recognise the difference between a simplification and a replacement with simple ideas. A simplification is a description that isn’t comprehensive, but is still true. Replacing a complex idea with simple one, on the other hand, often boils down to telling a loosely related story for the sake of entertainment.

Abstraction is essential to scientific inquiry, and often analogy for the sake of one’s own understanding or that of an audience can be a tricky thing to grapple with. All too often when scientists and science writers try to convey especially tricky ideas they end up deviating from their premises and consequently end up communicating something almost wholly different than what they intend to describe.

Over the last few weeks I pointed out a few examples of “exceptional” analogy in science writing. Attentive readers may have noticed they were all sort of… not good. They all fall a bit flat for purposes of communicating the science behind them.. A tough task to be sure, popularisers of science have to balance accuracy against confusing their audience with esoteric nonsense. Wasn’t it Isaac Asimov that said any sufficiently specialised language is indistinguishable from rampant babble? Hopefully you enjoyed the cartoons.

Every single time

This one gets used quite often, and typically will form the pinnacle of a long line of increasingly wayward analogies. Space is mind-bogglingly big (much larger than the distance to the chemist’s, thanks D.A.) and also quite weird.

Don't actually stick your hand in the LHC

I have heard this one from some very clever people. Presumably particle physicists all switched to the rock-star analogy after they grew tired of watching listeners eyes glaze over when they delve into maths.

Mitochondria-The engines of life

Internal combustion in the cell

This one might be the closest to the mark. The engine/mitochondria analogy gets the point across that metabolism involves trade-offs, but does very little to convey a better understanding of the underlying mechanisms.

A Phylogeny of Internet Journalism

While reading press coverage on the UW-Madison primate caloric restriction study for my essay, I kept getting deja vu as I noticed I was coming across the same language over and over. Much of this was due to the heavy reliance of early coverage on the press release from the University of Wisconsin-Madison, and sites buying stories from each other,and I decided it might be informative to make a phylogenetic tree of the coverage. To do so I used the text from the first two pages of google news results for “wisconsin monkey caloric restriction” and built a phylogenetic tree based on multiple sequence alignment after converting the english text to DNA sequences. I found a total of 27 articles on the CR study, and included one unrelated outgroup for a total of 28.

I used DNA Writer by Lensyl Urbano (CC BY NC SA) to convert the text of the article into a DNA sequence. This algorithm associates each character with a three nucleotide sequence, just like our own genome defines amino acids with a three letter code. Unlike our own genetic code, Urbano’s tool is not degenerate (each letter has only one corresponding 3 letter code). With base four (Adenine, Thymine, Guanine, and Cytosine provide our bases) there is room for 4^3 (64) unique codes. For example “I want to ride my bicycle” becomes

CTGAGCATGACTCTCTAGAGCTAGTGTAGCCACCTGTACCTAAGCACAGACAGCCATCTGTCAGACTCAATCCTA

The translation table and tool are available at http://earthsciweb.org/js/bio/dna-writer/.

To build the trees and alignments I used MAFFT. The sequences derived from each article can be relatively long, and MAFFT can handle longer sequences due to its use of the Fast Fourier Transform. MAFFT is available for download or use through a web interface here. I used the web interface, checking the Accurate and Minimum Linkage run options.

Once I had copied the tree in Nexus format, I ran FigTree by Andrew Rambaut to generate a useful graphical tree. I had included an unrelated article at Scientific American as an outgroup, and I chose the branch between that article and the group composed of press coverage of the UW macaque caloric restriction study as the root. This would correspond to a last common ancestor on a real phylogeny tree.

The resulting tree produces some interesting clades, for example ScienceDaily, esciencenews, and News-Medical, who essentially all just reproduced the UW-Madison press release, are grouped together. Another obvious group is the Tampa Bay Times and the Herald Tribune, which sourced the article from the New York Times and pared it down for their readers.

UWMacaqueCRPressTree

Here is the tree in Nexus format:

(((1_theScinder-:0.845,(((((((((((((((2_UWMPressRelease:0.0085,((4_escienceNews_UWM_:5.0E-4,5_ScienceDaily_UWPressRelease:5.0E-4):0.0,15_news-medical_UWM:5.0E-4):0.008):0.3115,26_aniNews:0.32):0.392,(14_natureWorldNews:0.7055,16_techTimes:0.7055):0.0065):0.006,25_expressUK:0.718):0.0025,20_hngn:0.7205):0.0195,(8_MedicalNewsToday:0.0,18_bayouBuzz_medicalNewsToday:0.0):0.74):0.0025,27_newsTonightAfrica:0.7425):0.047,(17_perezHilton:0.7805,(19_theVerge:0.6905,24_cbsLocalAtlanta:0.6905):0.09):0.009):0.0075,7_IFLS:0.797):0.007,21_seattlepi:0.804):0.006,12_nature:0.81):0.021,(6_yahooNews:0.0285,10_livescience:0.0285):0.8025):5.0E-4,((3_NYTimes:0.1875,11_HeraldTribune_NYT:0.1875):0.344,13_tampaBayTimes_NYT:0.5315):0.3):0.008,22_iol_dailyMail:0.8395):5.0E-4,9_healthDay/Philly_com:0.84):0.005):0.004,23_bbc:0.849):0.0245,28_OUTGROUPSciAmYeastyBeasties:0.8735);

. . .and this is a list of all the addresses for the articles I used and their labels on the tree: https://thescinder.com/pages/key-to-uwm-mac…logenetic-tree/