How to win the Nikon Small World photomicrography competition

The deadline for the Nikon Small World photomicrography competition is fast approaching (April 30th), and I’ve parsed some data on what types of images tend to win over since the contest’s inception in the late 1970s. The graphs below include data from both the stills and the newly minted video competition.

nikonWinnersBar

Figure 1: The total number of images utilizing each technique for places 1-20, Honorable Mentions, and Images of Distinction.

Right away we see that polarized light techniques have a distinct advantage in terms of how often we see them on the winners podium. This was a bit of a surprise. I’m always left with the impression of a preponderance of confocal images after each year’s announcement of winners, but I suppose confocal would have not been seeing much use until the 80s.

nikonHeatMapWinners

Figure 2: Heat map of the total number of images from 1st to 20th place.

Polarized light still easily dominates the field, with fluorescence and confocal making strong showings (you’ll notice many of the technique categories for NSW are overlapping). Techniques grouped under fluorescence do have a slightly higher number of 1st place finishes at 9 versus 8, and of total top 5 finishes (41 vs. 40). Beyond the top 5, polarized light has essentially more placers at every position.

Good luck to everyone who enters. I don’t have the rights to display my favorites from previous contests (e.g. this, this, or this), but I will display a few of my own, non-winner, images.

SONY DSC

Freshwater ostracod

SONY DSC

Freshwater copepod (cyclops)

 

Teaser photomicrography

Here’s something you may not know about the old manual Canon auto bellows and macro lens: the threaded adapter that connects a 20mm f3.5 (or 35mm f2.8) macro lens to the bellows employs the same threading standard as the typical microscope objective, known as the Royal Microscopical Society standard, 20.32 mm diameter with a pitch of 0.706 mm per turn, dates back to 1896 when it replaced an earlier standard.

The impact of this design choice for macrophotographers is that one can use any standard microscope objective, adding a great deal of options for imaging with the auto bellows and potentially pushing the capabilities of bellows macro into photomicrography. This can result in some very short working distances, and the sterics of the objective and subject mean there won’t generally be a lot of room for illumination sources. I designed this simple 3D printed microphotography objective hood for use with bright transverse illumination such as from a fiber optic illuminator. You may be familiar with the type of lens flare that can arise from this illumination setup-typically a haze effect that decreases the overall contrast of the image while increasing the brightness, particular toward the middle of the image.

I took the images below through a 10X NA = 0.25 objective (on the right, with lens hood).

hoodOn10xObjective

My camera battery is charging, no spare, and I don’t have a worthwhile illumination source handy to shoot proper test shots (these were illuminated with a handheld torch). Nonetheless, I couldn’t resist taking these half-portraits, and I’ll post them here as a teaser. I will use these gorgeous metallic bees for Lieberkühn tests as well. For now, enjoy these Osmia aglaia photos while my camera charges.

AglaiaOmmatidaeWOHood

AglaiaOmmatidaeWHood

A Phylogeny of Internet Journalism

While reading press coverage on the UW-Madison primate caloric restriction study for my essay, I kept getting deja vu as I noticed I was coming across the same language over and over. Much of this was due to the heavy reliance of early coverage on the press release from the University of Wisconsin-Madison, and sites buying stories from each other,and I decided it might be informative to make a phylogenetic tree of the coverage. To do so I used the text from the first two pages of google news results for “wisconsin monkey caloric restriction” and built a phylogenetic tree based on multiple sequence alignment after converting the english text to DNA sequences. I found a total of 27 articles on the CR study, and included one unrelated outgroup for a total of 28.

I used DNA Writer by Lensyl Urbano (CC BY NC SA) to convert the text of the article into a DNA sequence. This algorithm associates each character with a three nucleotide sequence, just like our own genome defines amino acids with a three letter code. Unlike our own genetic code, Urbano’s tool is not degenerate (each letter has only one corresponding 3 letter code). With base four (Adenine, Thymine, Guanine, and Cytosine provide our bases) there is room for 4^3 (64) unique codes. For example “I want to ride my bicycle” becomes

CTGAGCATGACTCTCTAGAGCTAGTGTAGCCACCTGTACCTAAGCACAGACAGCCATCTGTCAGACTCAATCCTA

The translation table and tool are available at http://earthsciweb.org/js/bio/dna-writer/.

To build the trees and alignments I used MAFFT. The sequences derived from each article can be relatively long, and MAFFT can handle longer sequences due to its use of the Fast Fourier Transform. MAFFT is available for download or use through a web interface here. I used the web interface, checking the Accurate and Minimum Linkage run options.

Once I had copied the tree in Nexus format, I ran FigTree by Andrew Rambaut to generate a useful graphical tree. I had included an unrelated article at Scientific American as an outgroup, and I chose the branch between that article and the group composed of press coverage of the UW macaque caloric restriction study as the root. This would correspond to a last common ancestor on a real phylogeny tree.

The resulting tree produces some interesting clades, for example ScienceDaily, esciencenews, and News-Medical, who essentially all just reproduced the UW-Madison press release, are grouped together. Another obvious group is the Tampa Bay Times and the Herald Tribune, which sourced the article from the New York Times and pared it down for their readers.

UWMacaqueCRPressTree

Here is the tree in Nexus format:

(((1_theScinder-:0.845,(((((((((((((((2_UWMPressRelease:0.0085,((4_escienceNews_UWM_:5.0E-4,5_ScienceDaily_UWPressRelease:5.0E-4):0.0,15_news-medical_UWM:5.0E-4):0.008):0.3115,26_aniNews:0.32):0.392,(14_natureWorldNews:0.7055,16_techTimes:0.7055):0.0065):0.006,25_expressUK:0.718):0.0025,20_hngn:0.7205):0.0195,(8_MedicalNewsToday:0.0,18_bayouBuzz_medicalNewsToday:0.0):0.74):0.0025,27_newsTonightAfrica:0.7425):0.047,(17_perezHilton:0.7805,(19_theVerge:0.6905,24_cbsLocalAtlanta:0.6905):0.09):0.009):0.0075,7_IFLS:0.797):0.007,21_seattlepi:0.804):0.006,12_nature:0.81):0.021,(6_yahooNews:0.0285,10_livescience:0.0285):0.8025):5.0E-4,((3_NYTimes:0.1875,11_HeraldTribune_NYT:0.1875):0.344,13_tampaBayTimes_NYT:0.5315):0.3):0.008,22_iol_dailyMail:0.8395):5.0E-4,9_healthDay/Philly_com:0.84):0.005):0.004,23_bbc:0.849):0.0245,28_OUTGROUPSciAmYeastyBeasties:0.8735);

. . .and this is a list of all the addresses for the articles I used and their labels on the tree: https://thescinder.com/pages/key-to-uwm-mac…logenetic-tree/

Come on you monkeys, do you want to live forever?

fatMonkey

Members of the control group for the Wisconsin National Primate Research Center caloric restriction study were fed an ad libitum diet of processed food.

The infinite monkey theorem, perhaps first invoked by French mathematician Émile Borel, posits that a monkey condemned to randomly punch keys on a typewriter for an infinite period of time would eventually produce the complete works of Shakespeare. The thought experiment may also be a good metaphor for encapsulating the experience of writing amateur science journalism.

Now consider the same experiment, replacing the generic monkey with members of the species Macaca mulatta, rhesus macaques, and the typewriter with as much processed food as the macaques can stuff into their furry little faces. Modestly pare down the timescale of the experiment from infinite time to about 25 years, increase the number of macaques from one lonely typist to about 38 individuals, and you have a pretty good first approximation of the control group for the University of Wisconsin-Madison Energy Metabolism and Chronic Disease study. You’ll be more familiar with the name used in the popular press, something including the words “caloric restriction,” “longevity” or “lifespan,” and “monkey.”

Caloric restriction (CR) has a long history of increasing longevity in yeast, nematodes, and mice. Youtube is full of mini-documentaries detailing the lives of the voluntarily emaciated, and many a blogger describes their day to day struggle to minimize caloric intake. The human caloric restriction community may have breathed a combined sigh of frustration and relief in 2012 when de facto rivals at the National Institutes of Aging (NIA), led by Dr. Rafa da Cabo, published an article contradicting the 2009 claim that it works in monkeys, too.

The most recent foray in the field of macaque CR published in Nature Communications by Dr. Ricki Colman et al. from Wisconsin, claims the NIA study control monkeys were actually on a CR diet as well, albeit less extreme than the 30% reduction of the experimental diet. They compared the mean weight of control monkeys in both studies to a national database of research macaque mass, the internet Primate Ageing Database or iPAD. The NIA controls were indeed as much as 15% lighter than the averages in the database, as would be expected if the animals were on a restricted diet. However, the UW controls were 5-10% heavier than average, blurring the line between normal feeding and overeating. iPAD does not distinguish between solitary or group housing in macaques, while both the NIA and the Wisconsin study house each individual separately.

The difference ultimately comes down to a discrepancy in what is considered a normal diet. Colman et al fed controls as much of a fortified, low-fat diet, relatively rich in sugar content, as they wanted. This ad libitum feeding was meant to mirror the eating habits of humans. At the NIA, controls wer given a diet based on estimated nutritional need, rather than appetite, and the food was less processed.

Since the goal of using primates in this research is to translate the results to humans, the differing diet choices for controls represent a meaningful philosophical difference: should we compare experiments to how we are or how we should be? Granted the industrialized world is now more overweight than not, and the control group studied by UW researchers may be a more realistic mirror of the human condition. But the survival benefits seen in the CR group may boil down to the benefits of eating a reasonable diet, avoiding excessive sugar and getting out of the cage once in a while. In short the UW study was designed in a way that would err on the side of confirming their hypothesis, while the NIA study was much more conducive to leaving room for the null alternative.

The controversy underlines the difficulty of taking promising results in “lower” animals and common model organisms and applying them to humans. The idea of putting 76 humans into controlled conditions for 25 years to test a radical diet or any other intervention is limited to the realm of the horror subtype of science fiction. This is why much of the health reports that trickle down into the popular press are based on “survey science,” in which respondents answer questionnaires regarding their diet and lifestyle, with varying degrees of quantitative oversight. This is in large part what leads to the impression that every other week the things that kill you are healthy again and vice-versa. It pays in terms of publicity for a university press office to encourage journalists to parrot a warning that eating meat is as deadly as smoking, even if human self-reporting is notoriously bad, and the underlying data may be a bit more subtle.

The climate for ethical considerations in even non-human primate research is evolving. In early 2013, the National Institutes of Health announced that they would begin retiring active chimpanzees from research with no intent to replace them. It is unlikely that either the experimental conditions for the NIA or the Wisconsin study will be reproduced in the near-future, so there won’t be any mulligans for CR in monkeys. This increases the scrutiny and standard of evidence for the results from these experiments, and makes it all the more important for the scientific community and popular press to come to cohesive conclusions.

The “need for consensus” may be overstated, as the studies are very different experiments. It is likely that those both scientifically literate and with the time and inclination to read the literature wouldn’t be misled in their conclusions, but this group will not include most people who may be affected by the outcome. After all, everyone gets old eventually, if they are lucky enough. The responsibility to avoid painting the situation as a sensational controversy and accurately convey the results of these experiments belongs to science journalists and academics in combination.

Caloric restriction reduces age-related and all-cause mortality in rhesus monkeys

Relevant articles (appended 2016/01/06):
Ricki J. Colman, T. Mark Beasley, Joseph W. Kemnitz, Sterling C. Johnson, Richard Weindruch & Rozalyn M. Anderson. Caloric restriction reduces age-related and all-cause mortality in rhesus monkeys. Nature Communications 5, Article number: 3557 doi:10.1038/ncomms4557
Received 12 October 2013 Accepted 05 March 2014 Published 01 April 2014

Evi M. Mercken, Bethany A. Carboneau, Susan M. Krzysik-Walker, and Rafael de Cabo.Of Mice and Men: The Benefits of Caloric Restriction, Exercise, and Mimetics Ageing Res Rev. 2012 Jul; 11(3): 390–398. Published online 2011 Dec 20. doi: 10.1016/j.arr.2011.11.005

Is the future of scientific publishing in-house open access?

WeirdFuture
Photo from flickr user Tom Marxchivist, 1952 cover by Basil Wolverton, used under CC attribution license.

Those of you that frequent theScinder know that I am pretty passionate about how science is disseminated, and you have probably noticed that, like their brethren in newsprint and magazine before them, the big-name publishers don’t know exactly how to react to a changing future, and despite what traditional publishers would have you believe, they are not immune to publishing tripe.

Nature may be butting heads with Duke University over requesting waivers for the open access policy in place there. Apparently the waiver request isn’t even necessarily based on the practical implementation of Duke’s open access policy (Nature allows articles to be made freely available in their final version 6 months after publication), but it does raise the question: how much hassle will universities and their faculty put up with before they take matters into their own hands? As MIT’s Samuel Gershman points out, modern publishing doesn’t cost all that much. Even the fairly exorbitant fees charged to authors by the “gold standard” of open access publishers may be a transient relic of the conventional (turning archaic?) publishing business model. This provides incentive for predatory publishing (as discussed in this article at The Scientist and the basis for the Bohannon article published in Science last October) But if peer review and editing is largely volunteer labour, performed as an essential component of the role of a researcher and with the bill largely footed as a public expenditure, why keep paying enormous subscription fees for traditional publishing? If the trend catches on, as it almost certainly will, leading institutions will continue to adopt open access policies and libraries will see less and less reason to keep paying for outdated subscriptions.

Relevant links:

Scholarly Publishing: Where is Plan B?

California univerisity system consider boycotting Nature Publishing Group

Samuel Gershman’s ideal publishing model, the Journal of Machine Learning Research

Quantitative comparisons of macrophotography with and without Lieberkühn reflectors

In order to quantitatively examine the effect of the the 3D printed Lieberkühn reflectors I described previously, I came up with two image quality metrics relevant to their use, both measured on the “dark side” of the image subject. The metrics we will look at today are average intensity and, as a measure of contrast, the standard deviation of pixel values on a line trace.

I’ll be using the Megachile photo from the previous post for these analyses.

The first line trace begins at right eye and extends back behind the wing:

DSC_0523redLineRightEye

DSC_0524redLineRightEye

RightEyeTraceValues

If we plot these values together, we see that the photo taken with the Lieberkühn (values in black) is brighter and brings out a lot more detail, while the photo taken without is relatively flat and dark. We see similar results for second and third traces, taken across the tegula and along the wing.

DSC_0523redLineAcrossThorax

DSC_0524redLineAcrossThorax

AcrossThoraxTraceValues

DSC_0523redLineWing

DSC_0524redLineWing

wingTraceValues

If we compare the average values:

octave3.2:25> mean(RE523(:,2)) %with Lieberkühn, right eye trace
ans = 102.00
octave3.2:26> mean(RE524(:,2))%w/o Lieberkühn, right eye trace
ans = 54.093
octave3.2:28> mean(AT523(:,2))%with Lieberkühn, trace across tegula
ans = 81.553
octave3.2:27> mean(AT524(:,2))%w/o Lieberkühn, trace across tegula
ans = 51.288
octave3.2:29> mean(W523(:,2))%with Lieberkühn, across the wing
ans = 103.85
octave3.2:30> mean(W524(:,2))%w/o Lieberkühn, across the wing
ans = 53.045

We see that taken together, the averages of the plots from the photo taken with the Lieberkühn are about 80% brighter than those without.

mean(Lieberkühn)/mean(no Lieberkühn) = 1.8142

octave3.2:56> std(RE523(:,2)))%with Lieberkühn, right eye trace
ans = 20.316
octave3.2:55> std(RE524(:,2))%w/o Lieberkühn, right eye trace
ans = 7.3926

octave3.2:54> std(AT523(:,2))%with Lieberkühn, trace across tegula
ans = 17.737
octave3.2:53> std(AT524(:,2))%w/o Lieberkühn, trace across tegula
ans = 13.227

octave3.2:52> std(W523(:,2))%with Lieberkühn, across the wing
ans = 12.746
octave3.2:51> std(W524(:,2))%w/o Lieberkühn, across the wing
ans = 8.2902

Using standard deviation as a metric for image detail, we get an increase of about 75% in standard deviation over the dark photo by using the reflector.

octave3.2:30> (20.316+17.737+12.746)/(7.3926+13.227+8.2902)
ans = 1.7572

The averages, standard deviation etc. may seem a bit redundant at this point; you don’t need to plot a pixel-value profile to see that the image with the reflector is much brighter and more detailed than the photo taken without.

Lens caps that screw on

Most lenses already have a standard, secure method for attaching accessories to the distal end. So why do we still put up with the infamy of squeeze-style caps that are so easily lost? Below are some iterations of my designs for threaded lens caps, designed with information on the lens filter thread standards from Wikipedia, and printed in various colors of Shapeways basic sintered plastic. They’re durable, can be colorful, and it’s possible to emboss custom text or an image on the front. Oh, and I never worry about them falling off in the bag.

DSC_0421 DSC_0423 DSC_0417 DSC_0132 DSC_0141 DSC_0933DSC_0568 DSC_0567

 

First tests of 3D printed Lieberkühn reflectors

Here I will report my initial tests of my Lieberkühn reflector designs, “hot” off the 3D printers at Shapeways. DSC_0503

I am testing a squeeze-to-attach Lieberkühn that roughly fits a Canon f/3.5 20mm focal length macro lens (above), and a 58mm threaded version (below), tested with a Canon 35mm f/2.8 manual tilt shift lens. I used a Canon auto macro bellows and a Nikon D5100 with an adapter for all test images.
DSC_0512 I haven’t added any reflective material to them yet, so they are essentially “Lieberkühn diffusers” for these tests. I used a domestic desk lamp with a 750 lumen halogen bulb to illuminate the specimens, for slightly off-axis trans illumination.

DSC_0528These are the legs on a cicada molt from last year’s 17-year brood. The photo was taken with the 35mm Canon tilt-shift lens at about the shortest macro-bellows distance possible.

DSC_0527

And here is a shot of the same view with the reflector attached. I used a 1/13 second exposures at ISO 1600 and f/5.6 for both shots.

DSC_0529

The large claws up front with (below) and without (above) the reflector. Again this was taken at f/5.6, an ISO 0f 1600, and 1/13 second exposure time. I increased the bellows distance slightly for this shot, increasing the magnification.

DSC_0530

Although the fill light is definitely better in the shots with the reflector, in some cases a photographer may prefer the image without using it, e.g. to bring out the small details with shadow. The cicada molt is partially transparent, giving a nice effect to the light transmitted through the subject.

I took the two photos of a leaf-cutter bee (Megachile genus, female) below with the same setup. The difference in lighting with and without the reflector is pretty drastic.

DSC_0524

DSC_0523

I made the next two pairs of photos using the 20mm macro lens and the squeeze Lieberkühn reflector. The photos contain some apparent lens flare resulting from the off-axis light source, manifesting as a slight general brightening (and resulting loss of contrast) in the middle of each image. I am not sure if the aberration is reduced with the addition of the reflector or if it just looks that way due to the rest of the image being brighter. Looks like a job for some quantitative comparisons, for the next post.

DSC_0499

DSC_0500

DSC_0498

DSC_0497

The position of the lamp and bellows stand were maintained for each pair of images. The bellows was set at the same distance but displaced between exposures to make room to attach the reflectors without disturbing the subjects, so the comparison images may be focused ever-so-slightly at different depths.

The lighting was definitely improved by the use of reflectors for these (mostly opaque) subjects. The images above were intended as a qualitative investigation, I will be looking into the performance and useability of the designs further.

As a final note, compare the print of the 58mm threaded reflector with the render from the STL file. The consistency is inhomogenous, with some bulges introduced during manufacture that were not part of the design file. Can’t say that I’m impressed with the print quality.

DSC_0532

render58mmLR

3D Printable Lens Hood Design

A lens hood is a shade that blocks out-of-frame light from reflecting off of the internals within the lens. This minimizes lens flares, so you can add them later in post. Just kidding.

Another form of lens flare is less obvious (and I don’t think J.J. Abrams uses it). It manifests as a haze across the majority of the frame making the image appear washed-out, and it never looks good. Unlike deliberate lens flares, it’s not obvious in the image itself where it comes from and doesn’t look dramatic.

To get the most effect from a lens hood, it needs to block out as much unwanted light as possible without actually showing up in the frame. This means that for any given lens at a certain focal length and field of view there will be a best angle for your lens hood.

The wikipedia article for angle of view gives an equation depending on the focal length and sensor size.

2cdot tan^{-1}(frac{d}{2f})

The variable d is the dimension of interest. For a lens hood with a simple circular cross section throughout the longest dimension should be used, e.g. the diagonal length of a typical rectilinear sensor. The doubling factor can be omitted if you want to work the angle in relation to the optical axis, rather than the total angle.

The lens hood below is a general purpose lens hood (also 3D printed) for lenses with a 58mm filter thread diameter. It flares out a bit, and the angle is wide enough to use with a ~27mm focal length lens.

DSC_0432

The images below show essentially the same 58mm diameter lens hood optimized for 16mm, 35mm, and 50mm, in order from left to right. The length of the hood in each case is 16mm. The shorter the focal length of the lens (and the larger the image sensor) the wider the angle, and the lens hood angle increases accordingly.

lensCapsEpi

lensCapsSide

lensCapsSideSide

So far, I have printed the general purpose lens hood, which errs on the side of wide-angle caution. Once I have the additional test pieces in hand, we’ll give ’em the old Pepsi challenge.

spaceship *= sqrt(-1);

imagSpaceship

The new Cosmos, starring Hayden planetarium director and media darling Neil Tyson, does it with a major revamp of the spaceship of the imagination: the machine used by both Tyson and Sagan to whisk viewers around spacetime.

The show visuals are fairly exceptional, but I’m not sold on the heavy reliance on CGI in the new Cosmos. I expect this show will pull in a fair amount of imagery from real telescopes. and I think it will be an important consideration to give the viewer cues with which to distinguish the rendered from the recorded. Exemplia gratis, what are the implications of showing an outside-looking-in view of the Milky Way in the same way as a (real) Earth-based view of the Andromeda galaxy? The givens and the assumptions get all mixed up.

And the lens flares OH! the lens flares. We seem to have steadfastly taken to incorporating lenses into our concept of an observation point, even when said lens has no reason to be there. I am going to ascribe these phenomena to a Mysterious Alien following closely behind Tyson’s voyage. We’ll try to discern the characteristics of the lenses used by Tyson’s tag-along as the show progresses, based on the lens flares and other aberrations.

Apparently, the Mysterious Alien following Tyson’s ship uses a lens with an eight leaf iris diaphragm:

cosmosEp1ExtOctApVenusMarked

cosmosEp1ExtOctApJupiterMarked

While the camera inside the cabin has a hexagonal diaphragm:

cosmosEp1ExtHexApPlutoMarked

Fox has made the smart and convenient decision to make the first episode of the new Cosmos available without underwriting everything else on cable:

Cosmos on TV (online)

But of course you can get the original online as well: