The Color Coded Tiers of Open Access

Open Access, or OA, in scientific publishing is bringing long-due attention to the question of availability. University libraries pay millions of dollars per year on subscriptions, sometimes under the influence of coercive package deals which encourage libraries to subscribe to a lump of journals rather than pick and choose the most relevant. Tim Gower, a fellow at Trinity College, Cambridge, reports that UK university libraries pay anywhere from £234,126 (Exeter) to £1,381,380 (University College London) in subscription costs to Elsevier alone. The excessive cost increases in journal subscriptions have led to substantial actions by some universities, including a cancellation of Elsevier subscriptions by Harvard, MIT avoiding a 3-year renewal commitment with Wiley and Elsevier, and selective cancellation of Elsevier journals by Cornell, to name a few.

The debate over the efficacy of the scientific publishing status quo is alive and well. By most counts the rate of retractions has increased, although it is not clear if more retractions are caused by more misconduct or better vigilance. eLife editor and Nobel Laureate Randy Schekman, among others, suspect the pressure to publish in superstar journals and over-reliance on impact factor leads to misplaced incentives and rewards showy failures. For example, the infamous “arsenic life” paper has amassed 287 citations as of this writing, as indexed by Google Scholar, and is unlikely to be retracted by Science as a result; the 287 references to the article could buoy an additional 8 articles, each with little to no citations, and still maintain Science’s impact factor of ~32.

So maybe you’ve become a bit frustrated with paywalls and the relative attention (and citation) monoply enjoyed by top-brand journals. Perhaps you are tired of your library paying exorbitant fees for bundled subscriptions. In any case, you’re considering pursuing open access for some of your work. It may be as simple as hosting PDFs of your articles on your own, but the options are diverse, as are the costs. OA is typically differentiated into two major types, designated by color: gold and green.

Green OA refers to self-hosting of copies by a person, lab, or university. These can be archived and made avaible as pre-prints, post-prints, or in the final, formatted version published by the journal. The latter method can be contentious with some publishers (see the recent spate at Nature over Duke University’s open access mandate). SHERPA/RoMEO further differentiates green OA friendliness of journals according to a range of colors according to what is allowed by a journal or publishers copyright transfer agreement.

  • green pre-print, post-print and publisher’s version
  • blue post-print and publisher’s version
  • yellow pre-print and publisher’s version
  • white not designated/not allowed

Gold OA is driven by the journal or publisher, rather than the author or university. These are the journals typically associated as open access, and they usually, but not always, charge a hefty fee to authors. Journals under the PLOS umbrella belong to this category, and big name publishers have been dipping their toes into gold open access as well.

A hybrid approach to publishing is becoming widespread. This is often implemented as making optional OA available at a few thousand dollars charged to the author, such as the policy employed by the Journal of Visual Experimentation or Optical Society publications. Other journals make the headline article for an issue freely available, often in advance of print publication, to draw interest. Many journals have explicit policies that OK green OA after a designated grace period, e.g. according to their policy Science allows free access to articles 12 months after initial publication.

OA has a role to play in the changing landscape of scientific publishing but there are still plenty of variations to be tried, and OA is no silver bullet for all that ails publication, funding, and promotion in science careers. Web resources such as figshare expand the role of data and figures, while online lab notebooks like OpenWetWare increase transparency. F1000 Research is experimenting with citeable, viewable, open peer review. OA won’t stop the occasional “arsenic life” paper from stealing headlines, but it definitely has a role to play in the future of access.

Additional OA resources:

The University of California Berkeley Library maintains an index of publishers with gold open access options and their associated publishing fees.

Duke University OA mandates versus Nature Publishing Group:
Duke Libraries take by Kevin Smith, JD: https://blogs.library.duke.edu/scholcomm/2014/03/27/attacking-academic-values/
Nature Publishing Group’s take by Grace Baynes http://blogs.nature.com/ofschemesandmemes/2014/03/28/clarifying-npgs-views-on-moral-rights-and-institutional-open-access-mandates

SHERPA/RoMEO. Provides shades of green to denote publisher’s OA archiving policies: http://www.sherpa.ac.uk/romeoinfo.html

Directory of Open Access Journals: http://doaj.org/

University of Colorado Denver Librarian Jeffrey Beall’s site: http://scholarlyoa.com/
Beall’s blog includes his list of potentially predatory publishers (http://scholarlyoa.com/publishers/), potentially predatory journals (http://scholarlyoa.com/individual-journals/), and the newer list of exploitative metric indexes (http://scholarlyoa.com/other-pages/misleading-metrics/). These are essential resources, particularly useful when conventional publishers conflate known exploitative publishers with OA as a whole.

An Unassuming Suggestion

For alleviating the burden and disadvantages experienced by women pursuing scientific careers, and for benefiting the public as a whole by reducing the impacts of said imposed hardships.

It is most unsettling to observe the halls of prominent scientific institutions, and their interactions twixt each other in both physical gatherings and writ in words across the machinations of the great endeavor of human progress, and to see the effects of a tremendous degree of selection against less common demographics. In particular, it is a rare occasion to see equal representation of men and women, and increasingly so as one climbs the tiers of seniority and compensation. Many women enter STEM research at the level of graduate training in a specialized discipline, but over time their presence is whittled down to a stalwart few.

I think it is uncontested that the research output, in terms of both innovation and quantity, that is lost along with the women who tend to leave technical STEM careers, is a tremendous detriment to nations in terms of productivity, health, and quality of life, and a burden to all societies plagued by the problem. Therefore, the individual who could come up with a cheap and easy method of reducing or eliminating the problem would deserve to have a statue constructed in their honor, a building bearing their name, or whatever the modern standard for public homage may be at the time the solution is enacted.

Many learned scholars have pointed out that a major exit point for women in STEM occurs at the decision point between career and family, specifically child-bearing and the associated obligations that follow. The dearth of women scientists in top roles can therefore be largely attributed to the nature of their reproductive capabilities. The premise follows that if society were to remove this bottleneck, women scientists would flourish. And I can clearly discern that such half-measures as paid maternity leave and availability of child care would not amount to much in terms of reducing the problem.

Some contend that the determined developmental cell plan of the common nematode Caenorhabditis elegans, makes their species the most useful model organism, while others may prefer the complex behavioural repertoire of the fruit fly, Drosophila melanogaster. Still others will settle for nothing less than a mammalian subject, and for them something along the lines of a small mouse, Mus musculus, or a laboratory brown rat, Rattus norvegicus, is the only method of interest. For others still, these multicellular types put the cart before the horse, and for these reserved researchers the only acceptable subject is brewer’s yeast, Saccharomyces cerevisae, or bacteria. Likewise, researchers in the physical sciences and mathematics have their own preferences for software programs, mathematical domains, approximations, etcetera.

Returning to the problem at hand: talented women leave scientific careers in droves at the bifurcation between choosing family and prioritizing career. In the absence of a suitable bioengineering solution that would push peak female fertility into the late 30s or beyond, I offer a solution, which, with proper implementation, promises to rid scientific endeavor of gender disparity once and for all.

I have been assured by a very knowing colleague that aspects of all major questions in physiology, neuroscience, psychology, etcetera, and a good deal of those in the physical sciences could be tested using the infant human as an experimental subject. Furthermore, in research areas disinterested with experimentation on living subjects, children represent an untapped labour resource and are ideally suited for many laboratory tasks.

What better model organism could be had than the larval specimen of the ubiquitous Homo sapiens? The clever reader will have followed this thread of reasoning to its penultimate conclusion: the method by which women may negate the career pitfalls associated with their sex, and, dare I say, propel themselves to advantages above and beyond their male cohorts, is not to forgo family in preference for professional aspirations. Rather, they must bring their progeny into the research fold, first as test subjects, and later as volunteer labour as the subjects mature.

Therefore, I do humbly offer up for public consideration that the so-called “leaky pipeline” of women exiting scientific research and technical professions, especially the component of said loss attributable to child-bearing and rearing, shall be plugged with the ready supply of women-scientists’ own children! I suspect that the advantages of this new arrangement will be sufficient to overcome institutional and personal impediments to representation at the top tiers of the scientific community. Additional measures, already suggested by others, such as marketing more laboratory equipment in rosy hues or encouraging research conferences to give out more feminine products as swag, would fill any remaining interstices left of the seniority and wage disparities currently based on gender.

In instances in which a particular avenue of study is outside of the specialization of the mother, collaborations with experts can be solicited to the advantage of the mother. I can even envisage resourceful mothers in research devising collaborative societies, in which entry is guaranteed by provision of a certain minimum number of children, and membership grants access to the combined progeny of the entire collective.

The small fingers and innate curiosity of young humans make them ideal for such mundane tasks as filling pipette tip boxes, working with small pieces of machinery, and washing glassware, as long as a suitable (non-monetary) reward is provided as incentive. Children are robust and heal quickly, obviating any effects of the clumsiness of growing limbs. Therefore, if a given child-subject is not suitable as a test subject for the experiments at hand, they can be employed at very low cost in the day-to-day running of the laboratory. The economy of such an arrangement can give women-scientists a small but effective advantage in times of sparse funding availability.

Being studious of brevity I will leave the concoction of additional uses of this untapped resource of experimental subjects and ready labour, which are sure to be highly numerous, to the reader. Of course, not being so violently defensive of my own simple idea, I remain open to alternative solutions to the problem, as long as these would be comparable in terms of ease, low expence, and efficaciousness. Whereas I have done my part to mitigate the problem of a STEM gender gap, I can therefore rest easy if the problem is not ameliorated due to a failure in implementing my suggestion. Further, having proffered this solution, my conscience will remain clear if some slight differences in the gender demographics in technical fields shall remain, as after having been fully informed of my suggestion described in this document, these differences could only be due to personal preferences of individuals.

The End

by special guest columnist Jean Brusque

Image of (left to right) Pierre, Irène and Marie Curie is public domain via an expired copyright. retrieved from http://en.wikipedia.org/wiki/File:Marie_Pierre_Irene_Curie.jpg

How to win the Nikon Small World photomicrography competition

The deadline for the Nikon Small World photomicrography competition is fast approaching (April 30th), and I’ve parsed some data on what types of images tend to win over since the contest’s inception in the late 1970s. The graphs below include data from both the stills and the newly minted video competition.

nikonWinnersBar

Figure 1: The total number of images utilizing each technique for places 1-20, Honorable Mentions, and Images of Distinction.

Right away we see that polarized light techniques have a distinct advantage in terms of how often we see them on the winners podium. This was a bit of a surprise. I’m always left with the impression of a preponderance of confocal images after each year’s announcement of winners, but I suppose confocal would have not been seeing much use until the 80s.

nikonHeatMapWinners

Figure 2: Heat map of the total number of images from 1st to 20th place.

Polarized light still easily dominates the field, with fluorescence and confocal making strong showings (you’ll notice many of the technique categories for NSW are overlapping). Techniques grouped under fluorescence do have a slightly higher number of 1st place finishes at 9 versus 8, and of total top 5 finishes (41 vs. 40). Beyond the top 5, polarized light has essentially more placers at every position.

Good luck to everyone who enters. I don’t have the rights to display my favorites from previous contests (e.g. this, this, or this), but I will display a few of my own, non-winner, images.

SONY DSC

Freshwater ostracod

SONY DSC

Freshwater copepod (cyclops)

 

Teaser photomicrography

Here’s something you may not know about the old manual Canon auto bellows and macro lens: the threaded adapter that connects a 20mm f3.5 (or 35mm f2.8) macro lens to the bellows employs the same threading standard as the typical microscope objective, known as the Royal Microscopical Society standard, 20.32 mm diameter with a pitch of 0.706 mm per turn, dates back to 1896 when it replaced an earlier standard.

The impact of this design choice for macrophotographers is that one can use any standard microscope objective, adding a great deal of options for imaging with the auto bellows and potentially pushing the capabilities of bellows macro into photomicrography. This can result in some very short working distances, and the sterics of the objective and subject mean there won’t generally be a lot of room for illumination sources. I designed this simple 3D printed microphotography objective hood for use with bright transverse illumination such as from a fiber optic illuminator. You may be familiar with the type of lens flare that can arise from this illumination setup-typically a haze effect that decreases the overall contrast of the image while increasing the brightness, particular toward the middle of the image.

I took the images below through a 10X NA = 0.25 objective (on the right, with lens hood).

hoodOn10xObjective

My camera battery is charging, no spare, and I don’t have a worthwhile illumination source handy to shoot proper test shots (these were illuminated with a handheld torch). Nonetheless, I couldn’t resist taking these half-portraits, and I’ll post them here as a teaser. I will use these gorgeous metallic bees for Lieberkühn tests as well. For now, enjoy these Osmia aglaia photos while my camera charges.

AglaiaOmmatidaeWOHood

AglaiaOmmatidaeWHood

A Phylogeny of Internet Journalism

While reading press coverage on the UW-Madison primate caloric restriction study for my essay, I kept getting deja vu as I noticed I was coming across the same language over and over. Much of this was due to the heavy reliance of early coverage on the press release from the University of Wisconsin-Madison, and sites buying stories from each other,and I decided it might be informative to make a phylogenetic tree of the coverage. To do so I used the text from the first two pages of google news results for “wisconsin monkey caloric restriction” and built a phylogenetic tree based on multiple sequence alignment after converting the english text to DNA sequences. I found a total of 27 articles on the CR study, and included one unrelated outgroup for a total of 28.

I used DNA Writer by Lensyl Urbano (CC BY NC SA) to convert the text of the article into a DNA sequence. This algorithm associates each character with a three nucleotide sequence, just like our own genome defines amino acids with a three letter code. Unlike our own genetic code, Urbano’s tool is not degenerate (each letter has only one corresponding 3 letter code). With base four (Adenine, Thymine, Guanine, and Cytosine provide our bases) there is room for 4^3 (64) unique codes. For example “I want to ride my bicycle” becomes

CTGAGCATGACTCTCTAGAGCTAGTGTAGCCACCTGTACCTAAGCACAGACAGCCATCTGTCAGACTCAATCCTA

The translation table and tool are available at http://earthsciweb.org/js/bio/dna-writer/.

To build the trees and alignments I used MAFFT. The sequences derived from each article can be relatively long, and MAFFT can handle longer sequences due to its use of the Fast Fourier Transform. MAFFT is available for download or use through a web interface here. I used the web interface, checking the Accurate and Minimum Linkage run options.

Once I had copied the tree in Nexus format, I ran FigTree by Andrew Rambaut to generate a useful graphical tree. I had included an unrelated article at Scientific American as an outgroup, and I chose the branch between that article and the group composed of press coverage of the UW macaque caloric restriction study as the root. This would correspond to a last common ancestor on a real phylogeny tree.

The resulting tree produces some interesting clades, for example ScienceDaily, esciencenews, and News-Medical, who essentially all just reproduced the UW-Madison press release, are grouped together. Another obvious group is the Tampa Bay Times and the Herald Tribune, which sourced the article from the New York Times and pared it down for their readers.

UWMacaqueCRPressTree

Here is the tree in Nexus format:

(((1_theScinder-:0.845,(((((((((((((((2_UWMPressRelease:0.0085,((4_escienceNews_UWM_:5.0E-4,5_ScienceDaily_UWPressRelease:5.0E-4):0.0,15_news-medical_UWM:5.0E-4):0.008):0.3115,26_aniNews:0.32):0.392,(14_natureWorldNews:0.7055,16_techTimes:0.7055):0.0065):0.006,25_expressUK:0.718):0.0025,20_hngn:0.7205):0.0195,(8_MedicalNewsToday:0.0,18_bayouBuzz_medicalNewsToday:0.0):0.74):0.0025,27_newsTonightAfrica:0.7425):0.047,(17_perezHilton:0.7805,(19_theVerge:0.6905,24_cbsLocalAtlanta:0.6905):0.09):0.009):0.0075,7_IFLS:0.797):0.007,21_seattlepi:0.804):0.006,12_nature:0.81):0.021,(6_yahooNews:0.0285,10_livescience:0.0285):0.8025):5.0E-4,((3_NYTimes:0.1875,11_HeraldTribune_NYT:0.1875):0.344,13_tampaBayTimes_NYT:0.5315):0.3):0.008,22_iol_dailyMail:0.8395):5.0E-4,9_healthDay/Philly_com:0.84):0.005):0.004,23_bbc:0.849):0.0245,28_OUTGROUPSciAmYeastyBeasties:0.8735);

. . .and this is a list of all the addresses for the articles I used and their labels on the tree: https://thescinder.com/pages/key-to-uwm-mac…logenetic-tree/

Come on you monkeys, do you want to live forever?

fatMonkey

Members of the control group for the Wisconsin National Primate Research Center caloric restriction study were fed an ad libitum diet of processed food.

The infinite monkey theorem, perhaps first invoked by French mathematician Émile Borel, posits that a monkey condemned to randomly punch keys on a typewriter for an infinite period of time would eventually produce the complete works of Shakespeare. The thought experiment may also be a good metaphor for encapsulating the experience of writing amateur science journalism.

Now consider the same experiment, replacing the generic monkey with members of the species Macaca mulatta, rhesus macaques, and the typewriter with as much processed food as the macaques can stuff into their furry little faces. Modestly pare down the timescale of the experiment from infinite time to about 25 years, increase the number of macaques from one lonely typist to about 38 individuals, and you have a pretty good first approximation of the control group for the University of Wisconsin-Madison Energy Metabolism and Chronic Disease study. You’ll be more familiar with the name used in the popular press, something including the words “caloric restriction,” “longevity” or “lifespan,” and “monkey.”

Caloric restriction (CR) has a long history of increasing longevity in yeast, nematodes, and mice. Youtube is full of mini-documentaries detailing the lives of the voluntarily emaciated, and many a blogger describes their day to day struggle to minimize caloric intake. The human caloric restriction community may have breathed a combined sigh of frustration and relief in 2012 when de facto rivals at the National Institutes of Aging (NIA), led by Dr. Rafa da Cabo, published an article contradicting the 2009 claim that it works in monkeys, too.

The most recent foray in the field of macaque CR published in Nature Communications by Dr. Ricki Colman et al. from Wisconsin, claims the NIA study control monkeys were actually on a CR diet as well, albeit less extreme than the 30% reduction of the experimental diet. They compared the mean weight of control monkeys in both studies to a national database of research macaque mass, the internet Primate Ageing Database or iPAD. The NIA controls were indeed as much as 15% lighter than the averages in the database, as would be expected if the animals were on a restricted diet. However, the UW controls were 5-10% heavier than average, blurring the line between normal feeding and overeating. iPAD does not distinguish between solitary or group housing in macaques, while both the NIA and the Wisconsin study house each individual separately.

The difference ultimately comes down to a discrepancy in what is considered a normal diet. Colman et al fed controls as much of a fortified, low-fat diet, relatively rich in sugar content, as they wanted. This ad libitum feeding was meant to mirror the eating habits of humans. At the NIA, controls wer given a diet based on estimated nutritional need, rather than appetite, and the food was less processed.

Since the goal of using primates in this research is to translate the results to humans, the differing diet choices for controls represent a meaningful philosophical difference: should we compare experiments to how we are or how we should be? Granted the industrialized world is now more overweight than not, and the control group studied by UW researchers may be a more realistic mirror of the human condition. But the survival benefits seen in the CR group may boil down to the benefits of eating a reasonable diet, avoiding excessive sugar and getting out of the cage once in a while. In short the UW study was designed in a way that would err on the side of confirming their hypothesis, while the NIA study was much more conducive to leaving room for the null alternative.

The controversy underlines the difficulty of taking promising results in “lower” animals and common model organisms and applying them to humans. The idea of putting 76 humans into controlled conditions for 25 years to test a radical diet or any other intervention is limited to the realm of the horror subtype of science fiction. This is why much of the health reports that trickle down into the popular press are based on “survey science,” in which respondents answer questionnaires regarding their diet and lifestyle, with varying degrees of quantitative oversight. This is in large part what leads to the impression that every other week the things that kill you are healthy again and vice-versa. It pays in terms of publicity for a university press office to encourage journalists to parrot a warning that eating meat is as deadly as smoking, even if human self-reporting is notoriously bad, and the underlying data may be a bit more subtle.

The climate for ethical considerations in even non-human primate research is evolving. In early 2013, the National Institutes of Health announced that they would begin retiring active chimpanzees from research with no intent to replace them. It is unlikely that either the experimental conditions for the NIA or the Wisconsin study will be reproduced in the near-future, so there won’t be any mulligans for CR in monkeys. This increases the scrutiny and standard of evidence for the results from these experiments, and makes it all the more important for the scientific community and popular press to come to cohesive conclusions.

The “need for consensus” may be overstated, as the studies are very different experiments. It is likely that those both scientifically literate and with the time and inclination to read the literature wouldn’t be misled in their conclusions, but this group will not include most people who may be affected by the outcome. After all, everyone gets old eventually, if they are lucky enough. The responsibility to avoid painting the situation as a sensational controversy and accurately convey the results of these experiments belongs to science journalists and academics in combination.

Caloric restriction reduces age-related and all-cause mortality in rhesus monkeys

Relevant articles (appended 2016/01/06):
Ricki J. Colman, T. Mark Beasley, Joseph W. Kemnitz, Sterling C. Johnson, Richard Weindruch & Rozalyn M. Anderson. Caloric restriction reduces age-related and all-cause mortality in rhesus monkeys. Nature Communications 5, Article number: 3557 doi:10.1038/ncomms4557
Received 12 October 2013 Accepted 05 March 2014 Published 01 April 2014

Evi M. Mercken, Bethany A. Carboneau, Susan M. Krzysik-Walker, and Rafael de Cabo.Of Mice and Men: The Benefits of Caloric Restriction, Exercise, and Mimetics Ageing Res Rev. 2012 Jul; 11(3): 390–398. Published online 2011 Dec 20. doi: 10.1016/j.arr.2011.11.005

Zone plates in OpenSCAD.

Remember in first-year physics when you inked zone plates onto glass and diffracted spots and images onto a screen further down an optics rail?

Me neither. For some obscure reason my own freshers’ physics neglected to include that experiment. I set out to rectify the problem with a bit of openSCAD code. From the wikipedia description, zone plate rings toggle from transparent to opaque every time the radius r_n satisfies the criteria:

r_n = sqrt{n lambda f + frac{n^2 lambda^2}{4}}

Where n is the ring number, lambda is the wavelength of light, and f is the focus distance.

Feel free to use the code, .svg file, or .png image below for your own zone plates. Everything is available under a Creative Commons Attribution License and can be found on Github: https://github.com/theBilder/zonePlates

zonePlateCCBY

//********************************************
//This code is provided under a Creative Commons Attribution license (creativecommons.org/). Feel free to use it any way you like, but please retain this comment header
//Q. Tyrell Davis
//thebilder.wordpress.com
//CC BY
//********************************************

//Parameters
lambda = 550*pow(10,-3);
//wavelength of light (in mm). Taken as an average green here.

zones = 15;
//number of zones. With too many zones the width of each zone will be too thin for practical fabrication

focal = 80;
//the focus distance for the zone plate

strutWidth = .75;
//width of the struts holding the zone plate rings

fineness = 68;
//determines how smooth the circles are

random = 1;
// 0 for ordered placement, 1 for random struts. Ordered placement will result in diffraction spikes

uiStruts = 4;
//Number of struts holding zones in place
//End parameters
//Formulae used to define the zone plate are from en.wikipedia.org/wiki/Zone_plate

vRand = random * rands(0,1,uiStruts*zones);
plateRadius = sqrt((zones+1)*focal*lambda)+2; //sqrt((zones)*focal*lambda+(pow(n,2)*pow(lambda,2))/4);

//uncomment to echo the thinnest ring width
echo(“thinnest ring = “,sqrt((zones)*focal*lambda+(pow(zones,2)*pow(lambda,2))/4)-sqrt((zones-1)*focal*lambda+(pow((zones-1),2)*pow(lambda,2))/4));
//echo(“plate radius = “,plateRadius);

//uncomment to echo the approx resolution
//echo(sqrt((zones)*focal*lambda+(pow(zones,2)*pow(lambda,2))/4)-sqrt((zones-1)*focal*lambda+(pow((zones-1),2)*pow(lambda,2))/4));

/
//Building the zone plate
difference(){
circle(r=plateRadius,$fn=fineness);
//translate([-55,-27.5]) square([85,55]); //comment the circle above and uncomment this to make a business card

for(n = [0:2:zones]){
union(){
difference(){
circle(r= sqrt((n)*focal*lambda+(pow(n,2)*pow(lambda,2))/4),$fn = fineness);
circle(r= sqrt((n-1)*focal*lambda+(pow(n,2)*pow(lambda,2))/4),$fn = fineness);

for(k = [1:uiStruts]){
rotate([0,0,(vRand[k*n-1])*360/uiStruts+k*360/uiStruts]){
translate([-.1+sqrt((n-1)*focal*lambda+(pow(n,2)*pow(lambda,2))/4),0,0]){
square([sqrt((n)*focal*lambda+(pow(n,2)*pow(lambda,2))/4),strutWidth],center = true);
}//translate
}//rotate
}//for

}//difference
}//union
}//for

}//difference